91
|
Thermo Fisher
cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id Cg06712013 Spats2 Atggttggagtagatgagat Acaccactacactccaccct Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id/product/Thermo Fisher Average 91 stars, based on 1 article reviews
cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id - by Bioz Stars,
2026-06
91/100 stars
|
Buy from Supplier |
86
|
GenScript corporation
seq id Seq Id, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/seq id/product/GenScript corporation Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
86
|
Medicago
seq id Seq Id, supplied by Medicago, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/seq id/product/Medicago Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
91
|
Thermo Fisher
cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id Cg08913523 Na Ggttttgtgggttggaagttag Accaccccctccttcaacta Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id/product/Thermo Fisher Average 91 stars, based on 1 article reviews
cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id - by Bioz Stars,
2026-06
91/100 stars
|
Buy from Supplier |
90
|
Carl Zeiss
gxxx-fniii9-10 (seq id no:20) Gxxx Fniii9 10 (Seq Id No:20), supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gxxx-fniii9-10 (seq id no:20)/product/Carl Zeiss Average 90 stars, based on 1 article reviews
gxxx-fniii9-10 (seq id no:20) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
MBL Life science
cmv pp65 peptides for hla-a*02:01 or hla-a*24:02 Cmv Pp65 Peptides For Hla A*02:01 Or Hla A*24:02, supplied by MBL Life science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cmv pp65 peptides for hla-a*02:01 or hla-a*24:02/product/MBL Life science Average 90 stars, based on 1 article reviews
cmv pp65 peptides for hla-a*02:01 or hla-a*24:02 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10) Two Udp Glycosyltransferase Sequences: Hv1 (Seq Id No:8) And Ugt76g1 (Seq Id No:10), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10)/product/GenScript corporation Average 90 stars, based on 1 article reviews
two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
ATUM Bio
codon-optimized s. rebaudiana kahe1 Codon Optimized S. Rebaudiana Kahe1, supplied by ATUM Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/codon-optimized s. rebaudiana kahe1/product/ATUM Bio Average 90 stars, based on 1 article reviews
codon-optimized s. rebaudiana kahe1 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
ImmunoGen Inc
us20080138898a1 seq id no: 1 and 2 Us20080138898a1 Seq Id No: 1 And 2, supplied by ImmunoGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/us20080138898a1 seq id no: 1 and 2/product/ImmunoGen Inc Average 90 stars, based on 1 article reviews
us20080138898a1 seq id no: 1 and 2 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
5′-tcc gct act ggc atc ggt-3′ seq id no:9 5′ Tcc Gct Act Ggc Atc Ggt 3′ Seq Id No:9, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5′-tcc gct act ggc atc ggt-3′ seq id no:9/product/Promega Average 90 stars, based on 1 article reviews
5′-tcc gct act ggc atc ggt-3′ seq id no:9 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
BioAutomation corporation
pcu18 forward primer: gc-puc18 fp=24mer (puc18 position 327–350) td=74.2 (seq id no: 1) 5′ gct gca agg cga tta agt tgg gta 3′ Pcu18 Forward Primer: Gc Puc18 Fp=24mer (Puc18 Position 327–350) Td=74.2 (Seq Id No: 1) 5′ Gct Gca Agg Cga Tta Agt Tgg Gta 3′, supplied by BioAutomation corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcu18 forward primer: gc-puc18 fp=24mer (puc18 position 327–350) td=74.2 (seq id no: 1) 5′ gct gca agg cga tta agt tgg gta 3′/product/BioAutomation corporation Average 90 stars, based on 1 article reviews
pcu18 forward primer: gc-puc18 fp=24mer (puc18 position 327–350) td=74.2 (seq id no: 1) 5′ gct gca agg cga tta agt tgg gta 3′ - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
TriLink
lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3) Lps Free 1018 Cpg Odn (5 Tgactgtgaacgttcgagatga 3), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3)/product/TriLink Average 90 stars, based on 1 article reviews
lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |