seq id Search Results


91
Thermo Fisher cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id
Cg06712013 Spats2 Atggttggagtagatgagat Acaccactacactccaccct Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
cg06712013 spats2 atggttggagtagatgagat acaccactacactccaccct seq id - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

86
GenScript corporation seq id
Seq Id, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/seq id/product/GenScript corporation
Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Medicago seq id
Seq Id, supplied by Medicago, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/seq id/product/Medicago
Average 86 stars, based on 1 article reviews
seq id - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

91
Thermo Fisher cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id
Cg08913523 Na Ggttttgtgggttggaagttag Accaccccctccttcaacta Seq Id, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
cg08913523 na ggttttgtgggttggaagttag accaccccctccttcaacta seq id - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

90
Carl Zeiss gxxx-fniii9-10 (seq id no:20)
Gxxx Fniii9 10 (Seq Id No:20), supplied by Carl Zeiss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gxxx-fniii9-10 (seq id no:20)/product/Carl Zeiss
Average 90 stars, based on 1 article reviews
gxxx-fniii9-10 (seq id no:20) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
MBL Life science cmv pp65 peptides for hla-a*02:01 or hla-a*24:02
Cmv Pp65 Peptides For Hla A*02:01 Or Hla A*24:02, supplied by MBL Life science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cmv pp65 peptides for hla-a*02:01 or hla-a*24:02/product/MBL Life science
Average 90 stars, based on 1 article reviews
cmv pp65 peptides for hla-a*02:01 or hla-a*24:02 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GenScript corporation two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10)
Two Udp Glycosyltransferase Sequences: Hv1 (Seq Id No:8) And Ugt76g1 (Seq Id No:10), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
two udp-glycosyltransferase sequences: hv1 (seq id no:8) and ugt76g1 (seq id no:10) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
ATUM Bio codon-optimized s. rebaudiana kahe1
Codon Optimized S. Rebaudiana Kahe1, supplied by ATUM Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/codon-optimized s. rebaudiana kahe1/product/ATUM Bio
Average 90 stars, based on 1 article reviews
codon-optimized s. rebaudiana kahe1 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
ImmunoGen Inc us20080138898a1 seq id no: 1 and 2
Us20080138898a1 Seq Id No: 1 And 2, supplied by ImmunoGen Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/us20080138898a1 seq id no: 1 and 2/product/ImmunoGen Inc
Average 90 stars, based on 1 article reviews
us20080138898a1 seq id no: 1 and 2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega 5′-tcc gct act ggc atc ggt-3′ seq id no:9
5′ Tcc Gct Act Ggc Atc Ggt 3′ Seq Id No:9, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/5′-tcc gct act ggc atc ggt-3′ seq id no:9/product/Promega
Average 90 stars, based on 1 article reviews
5′-tcc gct act ggc atc ggt-3′ seq id no:9 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
BioAutomation corporation pcu18 forward primer: gc-puc18 fp=24mer (puc18 position 327–350) td=74.2 (seq id no: 1) 5′ gct gca agg cga tta agt tgg gta 3′
Pcu18 Forward Primer: Gc Puc18 Fp=24mer (Puc18 Position 327–350) Td=74.2 (Seq Id No: 1) 5′ Gct Gca Agg Cga Tta Agt Tgg Gta 3′, supplied by BioAutomation corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcu18 forward primer: gc-puc18 fp=24mer (puc18 position 327–350) td=74.2 (seq id no: 1) 5′ gct gca agg cga tta agt tgg gta 3′/product/BioAutomation corporation
Average 90 stars, based on 1 article reviews
pcu18 forward primer: gc-puc18 fp=24mer (puc18 position 327–350) td=74.2 (seq id no: 1) 5′ gct gca agg cga tta agt tgg gta 3′ - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
TriLink lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3)
Lps Free 1018 Cpg Odn (5 Tgactgtgaacgttcgagatga 3), supplied by TriLink, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3)/product/TriLink
Average 90 stars, based on 1 article reviews
lps-free 1018 cpg-odn (5-tgactgtgaacgttcgagatga-3) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results